Performance of the ACMG-AMP criteria in a large familial renal glucosuria cohort with identified SLC5A2 sequence variants.

Familial Renal Glucosuria (FRG) is a co-dominantly inherited trait characterized by orthoglycaemic glucosuria. From 2003 to 2015 we have reported several cohorts validating SLC5A2 (16p11.2), encoding SGLT2 (Na+/glucose cotransporter family member 2), as the gene responsible for FRG. The aim of this work was to validate the variants identified in our extended FRG cohort of published, as well more recent unreported cases, according to the ACMG-AMP 2015 criteria. Forty-six variants were evaluated, including 16 novel alleles first described in this study. All are rare, ultra-rare or absent from population databases and most are missense changes. According to the ACMG-AMP standards, only 74% of the variants were classified as P/LP. The lack of descriptions of unrelated patients with similar variants or failing to test additional affected family members, averted a conclusion for pathogenicity in the alleles that scored VUS, highlighting the importance of both family testing and variant reporting. Finally, the cryo-EM structure of the hSGLT2-MAP17 complex in the empagliflozin-bound state improved the ACMG-AMP pathogenicity score by identifying critical/functional protein domains.

Hereditary renal glycosuria, diabetes and responses to SGLT2 inhibitor.

AIMS: To present the clinical features of two rare cases with hereditary renal glycosuria and diabetes, explore their responses to sodium-glucose cotransporter 2 (SGLT2) inhibitor, and summarize the reported solute carrier family 5 member 2 (SLC5A2) mutations and related phenotypes. METHODS: Two patients were followed up for 6.5 and 3 years respectively. SLC5A2 and hepatocyte nuclear factor 1-alpha (HNF1A) gene were sequenced. We used the flash glucose monitoring system to evaluate the efficacy of SGLT2 inhibitor treatment. Then we retrieved all the literature and analyzed SLC5A2 gene mutations and the phenotypes. RESULTS: During long-time follow up, the two patients had frequent unproportional renal glycosuria in the morning even when their fasting serum glucose was only slightly increased. A novel rare mutation V359G and a pathogenic rare mutation ivs7 + 5G > A in SLC5A2 gene were found respectively. In Case 1, the 24 h glucose excretion was 2.2 g/d and increased to 103 g/d after dapaglifozin treatment, whereas the average glucose (6.33 ± 1.56 vs. 6.28 ± 1.74 mmol/L), and time in range (TIR) (95% vs. 93%) were similar. In Case 2, the 24 h glycosuria was 121.4 g/d and increased to 185.8 g/day after dapaglifozin add-on therapy, with a further reduction of average glucose (9.11 ± 2.63 vs. 7.54 ± 2.39 mmol/L, p < 0.001) and better TIR (70% vs. 84%). We reviewed 139 cases with hereditary renal glycosuria and SLC5A2 gene mutation. The urine glucose was highest in patients with homozygous mutations [64.0(36.6-89.6)g/24 h] compared with compound heterozygous mutations [25.9(14.4-41.2)g/24 h] and heterozygous mutations [3.45(1.41-7.50)g/24 h] (p < 0.001). CONCLUSIONS: Genetic renal glycosuria could not protect individuals completely from developing diabetes. Patients with SGLT2 gene mutations are still responsive to the SGLT2 inhibitor treatment.

Clinical features of pediatric renal glucosuria cases due to SLC5A2 gene variants.

BACKGROUND: Familial renal glycosuria (FRG) is a rare renal tubular disorder characterized by a variable loss of glucose in the urine despite normal blood glucose levels, which is seen in a condition in which other tubular functions are preserved. In this study, the molecular and clinical characteristics of pediatric FRG cases due to SLC5A2 gene variants were defined. METHODS: Demographic features, diagnostic tests, and molecular analyses of patients with a diagnosis of FRG cases due to SLC5A2 gene variants were retrospectively analyzed between 2016 and 2019. RESULTS: The data of 16 patients who were clinically and genetically diagnosed with FRG in a 4-year period were analyzed. Seven (44%) of the cases were female and 9 (56%) were male. The median age at diagnosis was 6 years old (2 months old to 17 years old). Neuromotor development was found to be appropriate for the age in each case. Systemic blood pressure was evaluated as normal. A homozygous pathogenic variant in the SLC5A2 gene was detected in 14 patients in the genetic examination. A heterozygous variant was detected in one patient. In the other patient, two different heterozygous pathological variants were found in the SLC5A2 gene. CONCLUSIONS: It was revealed that growth and development were normal in children with glucosuria due to variations in the SCL5A2 gene. Renal function tests and urinary amino acid excretion were also within normal values. In our case series, the most common genetic variation in the SCL5A2 gene was the A219T (c.655G>A) variant.

Persistently high urine glucose levels caused by familial renal glycosuria.

Glycosuria generally occurs when the threshold for glucose reabsorption by the proximal renal tubule is exceeded or when reabsorption of filtered glucose is impaired. Although the discovery of glycosuria in a child will prompt screening for diabetes mellitus, it is also a sign of a rare tubulopathy called "familial renal glycosuria" (OMIM #233100). This tubulopathy is linked to a defect in the sodium-glucose co-transporter 2, encoded by the SLC5A2 gene. Here, we describe and discuss two pediatric cases in whom familial renal glycosuria was discovered fortuitously after the observation of persistently high urine glucose levels in the absence of hyperglycemia.

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. CONCLUSION: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Clinical and genetic analysis in a family with familial renal glucosuria: Identification of an N101K mutation in the sodium-glucose cotransporter 2 encoded by a solute carrier family 5 member 2 gene.

We report the identification of a mutation in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium-glucose cotransporter 2, in a family with familial renal glucosuria. The proband was a 26-year-old Japanese man referred to the diabetes division with repeated glucosuria without hyperglycemia. His mother, uncle and grandfather also had a history of glucosuria. A heterozygous missense mutation (c.303T>A:p.N101K) in SLC5A2 was identified in the patient and his mother, but not in 200 chromosomes from 100 healthy and unrelated individuals, or in 3,408 Japanese individuals in the Tohoku Medical Megabank. Furthermore, bioinformatics software predicted that this lesion would be pathogenic. We infer that the mutation led to clinically relevant sodium-glucose cotransporter 2 dysfunction. The patient showed no symptoms of hypoglycemia, but continuous glucose monitoring confirmed asymptomatic hypoglycemia.

Renal glucosuria is associated with lower body weight and lower rates of elevated systolic blood pressure: results of a nationwide cross-sectional study of 2.5 million adolescents.

BACKGROUND: Gene coding mutations found in sodium glucose co-transporters (SGLTs) are known to cause renal glucosuria. SGLT2 inhibitors have recently been shown to be effective hypoglycemic agents as well as possessing cardiovascular and renal protective properties. These beneficial effects have to some extent, been attributed to weight loss and reduced blood pressure. The aim of the current study was to evaluate the prevalence of renal glucosuria amongst a large cohort of Israeli adolescents and to investigate whether renal glucosuria is associated with lower body weight and lower blood pressure values. METHODS: Medical and socio-demographic data were collected from the Israeli Defense Force's conscription center's database. A cross-sectional study to evaluate the association between conscripts diagnosed as overweight [BMI percentiles of ≥ 85 and < 95 and obesity (≥ 95 BMI percentile)] and afflicted with renal glucosuria was conducted. In addition, we assessed the association of renal glucosuria with elevated diastolic and systolic blood pressure. Multinomial regression models were used. RESULTS: The final study cohort comprised 2,506,830 conscripts of whom 1108 (0.044%) were diagnosed with renal glucosuria, unrelated to diabetes mellitus, with males twice as affected compared to females. The adjusted odds ratio for overweight and obesity was 0.66 (95% CI 0.50-0.87) and 0.62 (95% CI 0.43-0.88), respectively. Adolescents afflicted with renal glucosuria were also less likely to have an elevated systolic blood pressure of 130-139 mmHg with an adjusted odds ratio of 0.74 (95% CI 0.60-0.90). CONCLUSIONS: Renal glucosuria is associated with lower body weight and obesity as well as with lower rates of elevated systolic blood pressure.

A novel compound heterozygous mutation in SLC5A2 contributes to familial renal glucosuria in a Chinese family, and a review of the relevant literature.

Familial renal glucosuria (FRG) is a rare condition that involves isolated glucosuria despite normal blood glucose levels. Mutations in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium­glucose cotransporter 2 (SGLT2), have been reported to be responsible for the disease. Genetic testing of the SLC5A2 gene was conducted in a Chinese family with FRG. A number of online tools were used to predict the potential effect of the identified mutations on SGLT2 function. Additionally, the SLC5A2 mutations previously reported in PubMed were summarized. A novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene in a Chinese child with FRG was identified. In total, 86 mutations of the SLC5A2 gene have been reported to be associated with FRG. The novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene may be responsible for the onset of FRG. The present study provides a starting point for further investigation of the molecular pathogenesis of the SLC5A2 gene mutation in patients with FRG.

Identification of ten novel SLC5A2 mutations and determination of the renal threshold for glucose excretion in Chinese patients with familial renal glucosuria.

BACKGROUND: Familial renal glucosuria (FRG) is a rare renal tubular disorder characterized by isolated persistent glucosuria without both abnormal glucose metabolism and any signs of proximal tubular dysfunction. SLC5A2 gene mutations are responsible for most FRG cases. METHODS: Quantitative test for 24-hour urine glucose and RTG were determined in 9 families (totaling 25 subjects). All coding regions, including intron-exon boundaries, were analyzed with PCR followed by direct sequence analysis. RESULTS: Ten novel mutations were identified (c.331 T > C, p.W111R; c.374T>C, p.M125T; c.394C>T, p.R132C; c.612G>C, p.Q204H; c.829C>T, p.P277S; c.880G>A, p.D294N; c.1129G>A, p.G377S; c.1194C>A, p.F398L; c.1540C > T, p.P514S and c.1573C>T, p.H525Y). c.886(-10_-31)del that is specific to Chinese population was found in 5 out of 9 families, with a mutation rate of 28% (5/18). The compound heterozygotes presented with much lower RTG values (1.28 ±â€¯0.10 mmol/L), compared with the carriers of heterozygous variants (5.14 ±â€¯0.77 mmol/L) (p<0.01); c.886(-10_-31)del heterozygotes had significant lower RTG values than others (4.43 ±â€¯0.37 vs 5.7 ±â€¯0.51 mmol/L; p<0.01). CONCLUSIONS: Ten novel SLC5A2 mutations are found and c.886(-10-31)del may be a hot spot mutation in Chinese population. Compound heterozygotes had much lower RTG values than simple heterozygotes. Mixed-meal tolerance test is a simple method for determining RTG in FRG patients.

Acquired renal glucosuria in an undifferentiated connective tissue disease patient with a SLC5A2 heterozygous mutation: A case report.

INTRODUCTION: Renal glucosuria is a renal tubular disorder caused by genetic conditions, drugs, and poisons. Mutations in the SLC5A2 gene are recently found to be responsible for the inherited renal glucosuria, while undifferentiated connective tissue disease (UCTD) was not considered pathogenic for renal glucosuria. Here, we present a case of acquired renal glucosuria in a UCTD patient. PATIENT CONCERNS: A 30-year-old woman was seen in the outpatient clinic for complaints of frequent urination and dysuria. Laboratory tests showed a urinary tract infection (UTI) and persistent renal glucosuria. After antibiotic treatment, the UTI symptoms were relieved, but the renal glucosuria remained. DIAGNOSIS: Laboratory tests ruled out renal tubular acidosis and diabetes mellitus. Genetic analysis showed a heterozygous mutations in the SLC5A2 gene. Meanwhile, immunological tests showed a high antinuclear antibody titer (1:160) and an elevated anti-Rho/SSA antibody level. Schirmer test, tear breakup time, and lip biopsy results were all negative. The patient did not meet the criteria for any known connective diseases. Therefore, she was diagnosed with UCTD. INTERVENTIONS: The patient was started with the treatment of Hydroxychloroquine. OUTCOMES: Hydroxychloroquine treatment resolved the renal glucosuria. The patient's follow- up urinalysis showed no glucosuria at all. LESSONS: This is the first case report to demonstrate that UCTD may induce renal glucosuria in a patient with a heterozygous mutation in SLC5A2. This case suggests that during the process of diagnosing renal glucosuria, in addition to familial renal glucosuria (FRG), autoimmune diseases, though rare, should also be taken into consideration.

Genetic analysis and literature review of Chinese patients with familial renal glucosuria: Identification of a novel SLC5A2 mutation.

BACKGROUND: Familial renal glucosuria (FRG) is an inherited renal tubular disorder characterized by persistent isolated glucosuria with normal blood glucose. SLC5A2 gene mutation was the causative of FRG. METHODS: Molecular genetic analysis of SLC5A2 gene by Sanger sequencing was conducted in two unrelated non-consanguineous Chinese families with isolated glucosuria. Extensive laboratory test and physical examination were performed. In silico algorithms were used to explore the potential effect of novel mutation on SGLT2 function. We also summarized the reported SLC5A2 mutations in the Chinese patients with FRG. RESULTS: A novel missense mutation (c.877A>T, p.Ser293Cys) in exon 3 was detected in proband 1 with weight loss accompanying by glucosuria and in her father with normal phenotype. In family 2, a previously reported compound heterozygous mutation (c.229G>C, p.Gly77Arg; c.1540C>T, p.Pro514Ser) was identified, and her healthy parents were heterozygous mutation carriers. The p.S293C mutation was predicted to be pathogenic. No hot spot mutation was found in reported Chinese patients with FRG. CONCLUSIONS: The novel pathogenic SLC5A2 mutation p.S293C was responsible for the onset of FRG. Our study further confirmed the co-dominant inheritance trait with variable penetrance and expanded the clinical and genetic spectrum of FRG.

Clinical and Genetic Features of Patients With Type 2 Diabetes and Renal Glycosuria.

Context: A sodium glucose cotransporter 2 (SGLT2) inhibitor, which increases urinary glucose excretion, was reported to decrease blood glucose levels and deaths among patients with type 2 diabetes mellitus (T2DM) and established cardiovascular disease. SLC5A2 and HNF1A mutations are associated with renal glycosuria, but their contributions to renal glycosuria in patients with T2DM are not well understood. Objective: To assess the clinical features of patients with T2DM and renal glycosuria and those with T2DM and low urinary glucose excretion (LUGE) and identify variants in the exons of SLC5A2 and HNF1A in patients with renal glycosuria and T2DM. Design: A total of 2044 Chinese patients with T2DM, including 64 patients with renal glycosuria and 58 patients with LUGE, were tested for their plasma and urine glucose concentrations after fasting. SLC5A2 and HNF1A exons were sequenced. Results: Compared with patients with LUGE, those with renal glycosuria were younger (P = 0.008), had lower body mass index (BMI) (P = 0.002) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) values (P < 0.0001), and were less likely to have hypertension (P = 0.006). HOMA-IR and BMI were negatively associated with renal glycosuria after adjusting for age, sex, hypertension, and insulin therapy. One novel mutation (V359G) of SLC5A2 in 32 patients with renal glycosuria and one known mutation (R131W) of HNF1A in 28 nonobese patients with renal glycosuria were identified. Conclusions: These findings suggest that there are subtypes of T2DM characterized by different urinary glucose excretion and cardiovascular risk factors. SLC5A2 and HNF1A mutations partially explain renal glycosuria in patients with T2DM.

MAP17 Is a Necessary Activator of Renal Na+/Glucose Cotransporter SGLT2.

The renal proximal tubule reabsorbs 90% of the filtered glucose load through the Na+-coupled glucose transporter SGLT2, and specific inhibitors of SGLT2 are now available to patients with diabetes to increase urinary glucose excretion. Using expression cloning, we identified an accessory protein, 17 kDa membrane-associated protein (MAP17), that increased SGLT2 activity in RNA-injected Xenopus oocytes by two orders of magnitude. Significant stimulation of SGLT2 activity also occurred in opossum kidney cells cotransfected with SGLT2 and MAP17. Notably, transfection with MAP17 did not change the quantity of SGLT2 protein at the cell surface in either cell type. To confirm the physiologic relevance of the MAP17-SGLT2 interaction, we studied a cohort of 60 individuals with familial renal glucosuria. One patient without any identifiable mutation in the SGLT2 coding gene (SLC5A2) displayed homozygosity for a splicing mutation (c.176+1G>A) in the MAP17 coding gene (PDZK1IP1). In the proximal tubule and in other tissues, MAP17 is known to interact with PDZK1, a scaffolding protein linked to other transporters, including Na+/H+ exchanger 3, and to signaling pathways, such as the A-kinase anchor protein 2/protein kinase A pathway. Thus, these results provide the basis for a more thorough characterization of SGLT2 which would include the possible effects of its inhibition on colocalized renal transporters.

Decreased expression and function of sodium-glucose co-transporter 2 from a novel C-terminal mutation: a case report.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, and the absence of other impairments of tubular function. Mutations in the sodium-glucose co-transporter 2 (SGLT2) gene (SLC5A2) are causative of FRG the long-term outcome of which is well know. In the search for potential new drug targets for SGLT2 inhibitors with which to treat the diabetes, expressional and functional studies of SGLT2 have been the focus of attention, but reports of these are rare. Furthermore, it is well known that the alleles in the C-terminal are very important for the expression and function in some genes. However, little is known about the effect of mutation in SLC5A2 C- terminal. CASE PRESENTATION: Here, we identified a FRG patient with urine glucose excretion 7.56 g/day and a novel SLC5A2 missense mutation, c.1891G > A/p.(E631K), by DNA sequencing. Expression and function of the mutant SGLT2 (631 K) fused to green fluorescent protein (GFP) were verified by western blotting, confocal laser microscopy, and transport activity assays in cultured HEK293 cells. Although wild-type SGLT2-GFP and 631 K mutant-GFP fusion proteins were properly expressed in a punctate pattern in the cell membrane, and co-localized with the cell membrane marker DiIC18(3), the expression of the mutant fusion protein was obviously decreased (24 %). Moreover, the uptake activity of the mutant SGLT2 631 K-GFP fusion protein was significantly decreased compared with wild-type (3629 ± 1082 vs. 7926 ± 1153, P < 0.001). CONCLUSION: These results suggest that the SLC5A2 C-terminal is very important for protein expression. We speculate that the observed reduced expression of the mutant transporter led to a decrease in transport of the glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3- diazol-4-yl)amino)-2-deoxyglucose. The current study provides a starting point for further investigations of the SGLT2 molecular mechanism in FRG families, and offers functional insights into the development of anti-diabetes drugs.

Influence of Familial Renal Glycosuria Due to Mutations in the SLC5A2 Gene on Changes in Glucose Tolerance over Time.

Familial renal glycosuria is an inherited disorder resulting in glucose excretion in the urine despite normal blood glucose concentrations. It is most commonly due to mutations in the SLC5A2 gene coding for the glucose transporter SGLT2 in the proximal tubule. Several drugs have been introduced as means to lower glucose in patients with type 2 diabetes targeting SGLT2 resulting in renal glycosuria, but no studies have addressed the potential effects of decreased renal glucose reabsorption and chronic glycosuria on the prevention of glucose intolerance. Here we present data on a large pedigree with renal glycosuria due to two mutations (c.300-303+2del and p.A343V) in the SLC5A2 gene. The mutations, which in vitro affected glucose transport in a cell line model, and the ensuing glycosuria were not associated with better glycemic control during a follow-up period of more than 10 years. One individual, who was compound heterozygous for mutations in the SLC5A2 gene suffered from severe urogenital candida infections and postprandial hypoglycemia. In conclusion, in this family with familial glycosuria we did not find any evidence that chronic loss of glucose in the urine would protect from deterioration of the glucose tolerance over time.

Hypothalamic POMC Deficiency Improves Glucose Tolerance Despite Insulin Resistance by Increasing Glycosuria.

Hypothalamic proopiomelanocortin (POMC) is essential for the physiological regulation of energy balance; however, its role in glucose homeostasis remains less clear. We show that hypothalamic arcuate nucleus (Arc)POMC-deficient mice, which develop severe obesity and insulin resistance, unexpectedly exhibit improved glucose tolerance and remain protected from hyperglycemia. To explain these paradoxical phenotypes, we hypothesized that an insulin-independent pathway is responsible for the enhanced glucose tolerance. Indeed, the mutant mice demonstrated increased glucose effectiveness and exaggerated glycosuria relative to wild-type littermate controls at comparable blood glucose concentrations. Central administration of the melanocortin receptor agonist melanotan II in mutant mice reversed alterations in glucose tolerance and glycosuria, whereas, conversely, administration of the antagonist Agouti-related peptide (Agrp) to wild-type mice enhanced glucose tolerance. The glycosuria of ArcPOMC-deficient mice was due to decreased levels of renal GLUT 2 (rGLUT2) but not sodium-glucose cotransporter 2 and was associated with reduced renal catecholamine content. Epinephrine treatment abolished the genotype differences in glucose tolerance and rGLUT2 levels, suggesting that reduced renal sympathetic nervous system (SNS) activity is the underlying mechanism for the observed glycosuria and improved glucose tolerance in ArcPOMC-deficient mice. Therefore, the ArcPOMC-SNS-rGLUT2 axis is potentially an insulin-independent therapeutic target to control diabetes.

Determination of the renal threshold for glucose excretion in Familial Renal Glucosuria.

BACKGROUND/AIMS: Familial Renal Glucosuria (FRG) is characterized by the presence of persistent isolated glucosuria in the absence of hyperglycemia. Mutations in SLC5A2, the gene coding for the sodium-glucose co-transporter 2 (SGLT2), are responsible for FRG. Phenotype/genotype correlations in FRG have mostly relied on the quantification of Urinary Glucose Excretion (UGE), which is dependent on both the filtered glucose load and the renal glucose reabsorptive capacity. In the current work, the renal threshold for glucose excretion (RTG) was determined in an FRG cohort, with the purpose of characterizing the impact of SGLT2 mutations on renal glucose transport. METHODS: From January to December of 2013, eight FRG individuals with identified SLC5A2 mutations were enrolled. Patients were given a Mixed-Meal Tolerance Test during which blood glucose and UGE were measured over a 4 h period and the data was used to calculate RTG, according to a recently validated protocol. RESULTS: In patients with homozygous mutations, RTG values were very low, with a mean (SD) of 0.95 (1.17) mmol/l, compared to commonly reported values of approximately 10-11.1 mmol/l in healthy subjects. In subjects with heterozygous mutations, mean (SD) RTG values were 4.91 (1.23) mmol/l, which are approximately one-half of the values in subjects without mutations. CONCLUSIONS: In FRG, mutations in SLC5A2 lead to reductions in RTG and increases in UGE. Because determination of RTG is not influenced by the filtered glucose load, the calculated RTG values provide a more refined measure of the impact of mutations on renal glucose transport than can be obtained from UGE alone.

Novel SLC5A2 variants contribute to renal glucosuria in Chinese families: abnormal expression and dysfunction of variant SLC5A2.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria despite normal serum glucose and the absence of overt tubular dysfunction. Variants in solute carrier family 5 (sodium-glucose cotransporter), member 2 (SLC5A2) have been reported in FRG patients. However, the functional and expression-related consequences of such variants have been scarcely investigated. In the current study, we studied five FRG families and identified six missense mutations, including four novel variants (c.1051T>C/.(C351R), c.1400T>C/p.(V467A), c.1420G>C/p.(A474P), c.1691G>A/p.(R564Q); RNA not analyzed) and two variants that had been previously reported (c.294C>A/p.(F98L), c.736C>T/p.(P246S); RNA not analyzed). The probands were either heterozygous or compound heterozygous for SLC5A2 variants and had glucosuria of 5.9%-19.6 g/day. Human 293 cells were transfected with plasmid constructs to study the expression and function of SLC5A2 variants in vitro. Western blotting revealed that the expression levels of SLC5A2-351R-GFP, SLC5A2-467A-GFP, SLC5A2-474P-GFP, and SLC5A2-564Q-GFP were significantly decreased compared with wild-type SLC5A2-GFP (37%-55%). Confocal microscopy revealed that three variants (c.1400T>C, c.1420G>C, c.1691G>A) resulted in a loss of the punctate membrane pattern typical of wild-type SLC5A2. All variants had a significantly lower transport capacity in than the wild-type control. The current study provides a starting point to further investigate the molecular mechanism of SLC5A2 in FRG families and provides functional clues for antidiabetes drugs.